Biologie (Botanik Und Zoologie) at Hochschule Weihenstephan-Triesdorf | Flashcards & Summaries

Select your language

Suggested languages for you:
Log In Start studying!

Lernmaterialien für Biologie (Botanik und Zoologie) an der Hochschule Weihenstephan-Triesdorf

Greife auf kostenlose Karteikarten, Zusammenfassungen, Übungsaufgaben und Altklausuren für deinen Biologie (Botanik und Zoologie) Kurs an der Hochschule Weihenstephan-Triesdorf zu.

TESTE DEIN WISSEN

Folge einer stummen Mutation

Lösung anzeigen
TESTE DEIN WISSEN

eine Base wird verändert, aber die Aminosäure bleibt gleich

Lösung ausblenden
TESTE DEIN WISSEN

Was ist bei der Pflege und Pflanzung von Hecken zu beachten?


Lösung anzeigen
TESTE DEIN WISSEN

→ Gefährdung benachbarter Straßen und Wege: man muss darauf achten dass keine Gefahr

besteht, dass die Sicht eingeschränkt wird. Es muss so zurückgeschnitten werden dass

Biodiversität erhalten bleibt

Lösung ausblenden
TESTE DEIN WISSEN

Der Status von Viren als Lebewesen ist umstritten. Wählen Sie aus den "8 Grundeigenschaften des Lebendigen" zwei Kriterien und erläutern Sie knapp, ob und/oder inwieweit Viren das jeweilige Kriterium erfüllen!

Lösung anzeigen
TESTE DEIN WISSEN

Gestalt: Viren haben bestimmte Gestalt, von der Form kann auf die Funktion geschlossen werden (Kriterium erfüllt)

Entwicklung: Gestalt ist genetisch festgelegt, ändert sich aber während der Entwicklung ?

Wachstum: durch Zellteilung und Volumenzunahme ? 

Stoffwechsel: Energieumwandlung, Stoffaufbau (Anabolismus), Stoffumbau (Metabolismus), Stoffabbau (Katabolismus) ? 

Bewegung, Reizbarkeit, Verhalten: Von allen Lebewesen zeigen Tiere am auffälligsten das Wechselspiel von Reizbarkeit und Bewegung. Die Summe aller Reaktionen und Handlungen wird Verhalten genannt. 

Fortpflanzung, Vermehrung: Lebewesen pflanzen sich durch Verschmelzung von Geschlechtszellen oder durch Teilung, Knospung oder Ableger fort; dabei kommt es meist auch zur Vermehrung. 

Vererbung: Aus einem Lebewesen geht immer ein gleichartiges Lebewesen hervor, da durch Vererbung die Eigenschaften eines Lebewesens auf seine Nachkommen übertragen werden. 

Evolution: Durch das Zusammenwirken von Veränderungen im Erbgut einer Art und des Wechselspiels zwischen den Individuen einer Art und ihrer Umwelt verändern sich die Lebewesen im Lauf der Zeit. 


Lösung ausblenden
TESTE DEIN WISSEN

Erläutern Sie an 2 Beispielen die gemeinsamen Interessen am Erhalt der

Biodiversität

Lösung anzeigen
TESTE DEIN WISSEN

→ Bienen: Ertragssteigerung durch Bestäubung, Honiglieferant

→ Blühflächen: Lebensraum für Insekten, Käfer, Schmetterlinge,.., sorgen für

Parasitenvernichtung, Bestäubung

Lösung ausblenden
TESTE DEIN WISSEN

Wie viele Aminosäuren gibt es?

Lösung anzeigen
TESTE DEIN WISSEN

Bedeutung: Baustein von Proteinen

- Anzahl sehr hoch

- Proteinogene AS: 20 beim Menschen

- essentielle AS: kann der Körper nicht selbst herstellen 

--> Anzahl 8: Valin, Methionin, Leucin, Isoleucin, Phenylalanin, Tryptophan, Threonin und Lysin 

- semiessentielle AS: Arginin, Histidin

Lösung ausblenden
TESTE DEIN WISSEN

Nennen Sie den Nutzen von Hautflüglern


Lösung anzeigen
TESTE DEIN WISSEN

→ Bestäubung (Ertragssteigerung)

→ Honiglieferant (Bienen)

→ Ungezieferbekämpfung

Lösung ausblenden
TESTE DEIN WISSEN

Ökologische Kenntnisse nutzen der Landwirtschaft ebenso wie dem Rest der

Gesellschaft. Nennen Sie 2 Kohlenstoffreduzierende Maßnahmen

Lösung anzeigen
TESTE DEIN WISSEN

→ Reifendruckregelung bei Traktoren → weniger Kraftstoffverbrauch → weniger CO2

→ AdBlue Technologie bei Traktoren → weniger Kraftstoffverbrauch → weniger CO2

--> Bodenleben Fördern --> kein Pflug, BB verringern

--> Festmist bevorzugen --> mehr Humusaufbau

Lösung ausblenden
TESTE DEIN WISSEN

Spielen Sie die RNA-Polymerase & Ribosom in Personalunion und synthetisieren

anhand der vorgegebenen DNA-Sequenz mRNA und Peptid

Lösung anzeigen
TESTE DEIN WISSEN

DNA: 5’ - CACATGTTCGTCAATTAGCAG - 3’

RNA: 3’ - GUGUALAAGLAGUUAAUCGUC - 5’

DNA: 3’ - GTGTACAAGCAGTTAATCGTC - 5’

RNA: 5’ - CAC * AUG UUC GUC AAU UAG CAG - 3’

Met (Start) Phe Kat Val Asn (Stopp)

Lösung ausblenden
TESTE DEIN WISSEN

Nennen Sie 2 Maßnahmen mit denen Sie Regenwürmer fordern können


Lösung anzeigen
TESTE DEIN WISSEN

→ flache Bodenbearbeitung

→ Humusgehalt hoch erhalten und fördern z.B. durch Zwischenfruchtanbau

Lösung ausblenden
TESTE DEIN WISSEN

Arten von Mutationen

Lösung anzeigen
TESTE DEIN WISSEN

Punktmutationen


Stumme Mutation: 

Ein Basenpaar wird zwar ausgetauscht, durch die Redundanz des genetischen Codes bleibt die Aminosäure jedoch dieselbe.


Missense-Mutation: 

Ein Basenpaar wird ausgetauscht und das Triplett codiert für eine andere Aminosäure; die Raumstruktur des entstehenden Proteins kann sich daraufhin ändern.


Nonsense-Mutation: 

Ein Basenpaar wird ausgetauscht und das Triplett codiert nun für ein Stop-Codon; Translation des Proteins wird daraufhin abgebrochen, das Protein bleibt unvollständig und ist meist funktionsunfähig.


Rasterschubmutation


Ein Nukleotidpaar wird ausgetauscht, sodass sich das Leseraster verschiebt und sich nicht nur eine Aminosäure, sondern auch alle auf die Mutation folgenden ändern.

Deletion:

Ein oder mehrere Nukleotidpaare werden aus der Sequenz gelöscht.

Insertion:

Ein oder mehrere Nukleotidpaare werden in die Sequenz eingefügt (hier entsteht dadurch ein Stopp-Codon, es kann jedoch genauso ein Triplett entstehen, welches für eine andere Aminosäure codiert).

Lösung ausblenden
TESTE DEIN WISSEN

Die Ausnutzung des Heterosiseffekts ist nur dann eine feine Sache wenn…

Lösung anzeigen
TESTE DEIN WISSEN

→… es nur eine Nachzucht-Generation gibt, da diese sehr leistungsstark ist der Effekt ab der darauffolgenden Generation wieder abnimmt und man so wieder leistungsschwächere Tiere sind

Lösung ausblenden
TESTE DEIN WISSEN

Zellorganelle

Lösung anzeigen
TESTE DEIN WISSEN

a) Festigung Turgor --> Vakuole

b) Photosynthese --> Chloroplast

c) Energiebereitstellung --> Mitochondrien

d) Proteinbiosynthese --> Ribosom

Lösung ausblenden
  • 98937 Karteikarten
  • 1708 Studierende
  • 96 Lernmaterialien

Beispielhafte Karteikarten für deinen Biologie (Botanik und Zoologie) Kurs an der Hochschule Weihenstephan-Triesdorf - von Kommilitonen auf StudySmarter erstellt!

Q:

Folge einer stummen Mutation

A:

eine Base wird verändert, aber die Aminosäure bleibt gleich

Q:

Was ist bei der Pflege und Pflanzung von Hecken zu beachten?


A:

→ Gefährdung benachbarter Straßen und Wege: man muss darauf achten dass keine Gefahr

besteht, dass die Sicht eingeschränkt wird. Es muss so zurückgeschnitten werden dass

Biodiversität erhalten bleibt

Q:

Der Status von Viren als Lebewesen ist umstritten. Wählen Sie aus den "8 Grundeigenschaften des Lebendigen" zwei Kriterien und erläutern Sie knapp, ob und/oder inwieweit Viren das jeweilige Kriterium erfüllen!

A:

Gestalt: Viren haben bestimmte Gestalt, von der Form kann auf die Funktion geschlossen werden (Kriterium erfüllt)

Entwicklung: Gestalt ist genetisch festgelegt, ändert sich aber während der Entwicklung ?

Wachstum: durch Zellteilung und Volumenzunahme ? 

Stoffwechsel: Energieumwandlung, Stoffaufbau (Anabolismus), Stoffumbau (Metabolismus), Stoffabbau (Katabolismus) ? 

Bewegung, Reizbarkeit, Verhalten: Von allen Lebewesen zeigen Tiere am auffälligsten das Wechselspiel von Reizbarkeit und Bewegung. Die Summe aller Reaktionen und Handlungen wird Verhalten genannt. 

Fortpflanzung, Vermehrung: Lebewesen pflanzen sich durch Verschmelzung von Geschlechtszellen oder durch Teilung, Knospung oder Ableger fort; dabei kommt es meist auch zur Vermehrung. 

Vererbung: Aus einem Lebewesen geht immer ein gleichartiges Lebewesen hervor, da durch Vererbung die Eigenschaften eines Lebewesens auf seine Nachkommen übertragen werden. 

Evolution: Durch das Zusammenwirken von Veränderungen im Erbgut einer Art und des Wechselspiels zwischen den Individuen einer Art und ihrer Umwelt verändern sich die Lebewesen im Lauf der Zeit. 


Q:

Erläutern Sie an 2 Beispielen die gemeinsamen Interessen am Erhalt der

Biodiversität

A:

→ Bienen: Ertragssteigerung durch Bestäubung, Honiglieferant

→ Blühflächen: Lebensraum für Insekten, Käfer, Schmetterlinge,.., sorgen für

Parasitenvernichtung, Bestäubung

Q:

Wie viele Aminosäuren gibt es?

A:

Bedeutung: Baustein von Proteinen

- Anzahl sehr hoch

- Proteinogene AS: 20 beim Menschen

- essentielle AS: kann der Körper nicht selbst herstellen 

--> Anzahl 8: Valin, Methionin, Leucin, Isoleucin, Phenylalanin, Tryptophan, Threonin und Lysin 

- semiessentielle AS: Arginin, Histidin

Mehr Karteikarten anzeigen
Q:

Nennen Sie den Nutzen von Hautflüglern


A:

→ Bestäubung (Ertragssteigerung)

→ Honiglieferant (Bienen)

→ Ungezieferbekämpfung

Q:

Ökologische Kenntnisse nutzen der Landwirtschaft ebenso wie dem Rest der

Gesellschaft. Nennen Sie 2 Kohlenstoffreduzierende Maßnahmen

A:

→ Reifendruckregelung bei Traktoren → weniger Kraftstoffverbrauch → weniger CO2

→ AdBlue Technologie bei Traktoren → weniger Kraftstoffverbrauch → weniger CO2

--> Bodenleben Fördern --> kein Pflug, BB verringern

--> Festmist bevorzugen --> mehr Humusaufbau

Q:

Spielen Sie die RNA-Polymerase & Ribosom in Personalunion und synthetisieren

anhand der vorgegebenen DNA-Sequenz mRNA und Peptid

A:

DNA: 5’ - CACATGTTCGTCAATTAGCAG - 3’

RNA: 3’ - GUGUALAAGLAGUUAAUCGUC - 5’

DNA: 3’ - GTGTACAAGCAGTTAATCGTC - 5’

RNA: 5’ - CAC * AUG UUC GUC AAU UAG CAG - 3’

Met (Start) Phe Kat Val Asn (Stopp)

Q:

Nennen Sie 2 Maßnahmen mit denen Sie Regenwürmer fordern können


A:

→ flache Bodenbearbeitung

→ Humusgehalt hoch erhalten und fördern z.B. durch Zwischenfruchtanbau

Q:

Arten von Mutationen

A:

Punktmutationen


Stumme Mutation: 

Ein Basenpaar wird zwar ausgetauscht, durch die Redundanz des genetischen Codes bleibt die Aminosäure jedoch dieselbe.


Missense-Mutation: 

Ein Basenpaar wird ausgetauscht und das Triplett codiert für eine andere Aminosäure; die Raumstruktur des entstehenden Proteins kann sich daraufhin ändern.


Nonsense-Mutation: 

Ein Basenpaar wird ausgetauscht und das Triplett codiert nun für ein Stop-Codon; Translation des Proteins wird daraufhin abgebrochen, das Protein bleibt unvollständig und ist meist funktionsunfähig.


Rasterschubmutation


Ein Nukleotidpaar wird ausgetauscht, sodass sich das Leseraster verschiebt und sich nicht nur eine Aminosäure, sondern auch alle auf die Mutation folgenden ändern.

Deletion:

Ein oder mehrere Nukleotidpaare werden aus der Sequenz gelöscht.

Insertion:

Ein oder mehrere Nukleotidpaare werden in die Sequenz eingefügt (hier entsteht dadurch ein Stopp-Codon, es kann jedoch genauso ein Triplett entstehen, welches für eine andere Aminosäure codiert).

Q:

Die Ausnutzung des Heterosiseffekts ist nur dann eine feine Sache wenn…

A:

→… es nur eine Nachzucht-Generation gibt, da diese sehr leistungsstark ist der Effekt ab der darauffolgenden Generation wieder abnimmt und man so wieder leistungsschwächere Tiere sind

Q:

Zellorganelle

A:

a) Festigung Turgor --> Vakuole

b) Photosynthese --> Chloroplast

c) Energiebereitstellung --> Mitochondrien

d) Proteinbiosynthese --> Ribosom

Biologie (Botanik und Zoologie)

Erstelle und finde Lernmaterialien auf StudySmarter.

Greife kostenlos auf tausende geteilte Karteikarten, Zusammenfassungen, Altklausuren und mehr zu.

Jetzt loslegen

Das sind die beliebtesten StudySmarter Kurse für deinen Studiengang Biologie (Botanik und Zoologie) an der Hochschule Weihenstephan-Triesdorf

Für deinen Studiengang Biologie (Botanik und Zoologie) an der Hochschule Weihenstephan-Triesdorf gibt es bereits viele Kurse, die von deinen Kommilitonen auf StudySmarter erstellt wurden. Karteikarten, Zusammenfassungen, Altklausuren, Übungsaufgaben und mehr warten auf dich!

Das sind die beliebtesten Biologie (Botanik und Zoologie) Kurse im gesamten StudySmarter Universum

botanik und zoologie I

Pädagogische Hochschule Ludwigsburg

Zum Kurs
Zellbiologie und Botanik

Universität Regensburg

Zum Kurs
Botanik (Biologie I)

Universität Hohenheim

Zum Kurs

Die all-in-one Lernapp für Studierende

Greife auf Millionen geteilter Lernmaterialien der StudySmarter Community zu
Kostenlos anmelden Biologie (Botanik und Zoologie)
Erstelle Karteikarten und Zusammenfassungen mit den StudySmarter Tools
Kostenlos loslegen Biologie (Botanik und Zoologie)